High-efficiency multi-scale holographic volumetric 3D printing with a phase light modulator

Chattez avec Graph Search

Posez n’importe quelle question sur les cours, conférences, exercices, recherches, actualités, etc. de l’EPFL ou essayez les exemples de questions ci-dessous.

AVERTISSEMENT : Le chatbot Graph n'est pas programmé pour fournir des réponses explicites ou catégoriques à vos questions. Il transforme plutôt vos questions en demandes API qui sont distribuées aux différents services informatiques officiellement administrés par l'EPFL. Son but est uniquement de collecter et de recommander des références pertinentes à des contenus que vous pouvez explorer pour vous aider à répondre à vos questions.

The temp. dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 K. The value of 2hJ(N,N) was obsd. to decrease monotonically for all four base pairs with increasing temp. The temp. dependence of 2hJ(N,N) was found to be more pronounced for the A-U base pair than for G-C base pairs. An earlier study of cross-correlatio

The properties of semiconductor laser diodes for trace gas measurements are reviewed. First, the modulation characteristics of these lasers are discussed. Then, two sensitive spectroscopic methods using a frequency-modulated near-IR laser are presented and their performance compared. In the λ = 2 μm range, second-harmonic optical detection has shown a 20 times better detection limit than photoacoustic detection. The extension of these methods to longer wavelengths is finally discussed.

We demonstrate edge-emitting lasers based on self-assembled InAs quantum dots (QDs) on GaAs substrates. The InAs QDs are embedded in an InGaAs quantum well (QW) to red-shift the lasing transition. The lasers emit at lambda=1.2 mum with threshold current densities approximate to100 A/cm(2). Maximum modal gains on the order of 5 cm(-1) are deduced for a single QD sheet.

First experiments of coupling a free electron laser to a scanning near-field optical microscope (SNOM) are presented. To address the question of how important such spectroscopy can be for near-field infrared microscopy, we acquired images of the same region of the sample under investigation at several photon wavelengths. SNOM reflectivity images revealed features that were not present in the corresponding shear-force (topology) ones and which were due to localized changes in the bulk properties of the sampl

Among all non-linear optical effects observed in single-mode optical fibres, stimulated Brillouin scattering (SBS) is of particular importance since it has numerous practical implications. SBS occurs when laser waves are scattered through the interaction of light with hypersonic acoustic waves in the medium. It manifests through the generation of a backscattered Stokes wave that carries most of the input optical power once a definite intensity level is reached within the fibre core. It limits the maximum op

By using chemical beam epitaxy at growth temperatures as low as 460-480 degrees C, we have overcome strain relaxation problems that prevented so far the successful use of InAsP quantum wells in 1.55 mu m lasers. Five quantum well InAsP/InGaAsP horizontal cavity lasers showed 88% internal efficiency, 1.6 cm(-1) losses per well, and 33 A/cm(2) transparency current density per well, which equal or even surpass the best published characteristics for 1.55 mu m wavelength lasers based on any material system. More

We have measured phase modulation in the first chemical beam epitaxy grown InGaAsP/InP barrier, reservoir, and quantum well electron transfer structures. We obtain a negative refractive index change, DELTAn, similar to that found in the InGaAs/InAlAs system. Using new designs to reduce the leakage current in this material system, we obtain a leakage current

New radio-frequency pulse envelopes are presented for selective inversion and in-phase excitation in NMR. The envelope functions consist of superpositions of three or four time-shifted Gaussians with optimized widths and peak amplitudes. The offset dependence closely approaches ideal rectangular functions, as verified by simulation and expt. [on SciFinder (R)]

High-efficiency multi-scale holographic volumetric 3D printing with a phase light modulator

Chattez avec Graph Search

Temperature dependence of internucleotide nitrogen-nitrogen scalar couplings in RNA

Trace gas measurement using IR laser diodes

Long-wavelength edge-emitting lasers on gallium arsenide using InAs quantum dots embedded in InGaAs

First experimental results with the free electron laser coupled to a scanning near-field optical microscope

La diffusion Brillouin dans les fibres optiques : étude et application aux capteurs distribués

Low Threshold 1.55 µm Wavelength InAsP/InGaAsP Strained Multi-Quantum Well Laser Diode Grown by Chemical Beam Epitaxy

Phase Modulation in Ingaasp Barrier, Reservoir, and Quantum-Well Electron-Transfer Structures, Grown by Chemical Beam Epitaxy

Gaussian pulse cascades: new analytical functions for rectangular selective inversion and in-phase excitation in NMR