Publication

Temperature dependence of internucleotide nitrogen-nitrogen scalar couplings in RNA

Geoffrey Bodenhausen, Dominique Früh
2002
Journal Articles

Abstract

The temp. dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 K. The value of 2hJ(N,N) was obsd. to decrease monotonically for all four base pairs with increasing temp. The temp. dependence of 2hJ(N,N) was found to be more pronounced for the A-U base pair than for G-C base pairs. An earlier study of cross-correlation effects at 296 K appeared to indicate a reduced mobility of the A-U base pair, as evidenced by small contributions of chem. shift modulation to relaxation rates. [on SciFinder (R)]

Official source

https://infoscience.epfl.ch/entities/publication/19ab2d7a-7c2c-4d62-967a-0a871e875403

About this result

This page is automatically generated and may contain information that is not correct, complete, up-to-date, or relevant to your search query. The same applies to every other page on this website. Please make sure to verify the information with EPFL's official sources.

Graph Chat

Chat with Graph Search

Ask any question about EPFL courses, lectures, exercises, research, news, etc. or try the example questions below.

DISCLAIMER: The Graph Chatbot is not programmed to provide explicit or categorical answers to your questions. Rather, it transforms your questions into API requests that are distributed across the various IT services officially administered by EPFL. Its purpose is solely to collect and recommend relevant references to content that you can explore to help you answer your questions.

Geoffrey Bodenhausen, Dominique Früh
2002
Journal Articles

Abstract

Official source

https://infoscience.epfl.ch/entities/publication/19ab2d7a-7c2c-4d62-967a-0a871e875403

About this result

Related concepts (32)

Nucleobase

Nucleobases (nitrogenous bases or simply bases) are nitrogen-containing biological compounds that form nucleosides, which, in turn, are components of nucleotides, with all of these monomers constituting the basic building blocks of nucleic acids. The ability of nucleobases to form base pairs and to stack one upon another leads directly to long-chain helical structures such as ribonucleic acid (RNA) and deoxyribonucleic acid (DNA). Five nucleobases—adenine (A), cytosine (C), guanine (G), thymine (T), and uracil (U)—are called primary or canonical.

Modulation

In electronics and telecommunications, modulation is the process of varying one or more properties of a periodic waveform, called the carrier signal, with a separate signal called the modulation signal that typically contains information to be transmitted. For example, the modulation signal might be an audio signal representing sound from a microphone, a video signal representing moving images from a video camera, or a digital signal representing a sequence of binary digits, a bitstream from a computer.

Base pair

A base pair (bp) is a fundamental unit of double-stranded nucleic acids consisting of two nucleobases bound to each other by hydrogen bonds. They form the building blocks of the DNA double helix and contribute to the folded structure of both DNA and RNA. Dictated by specific hydrogen bonding patterns, "Watson–Crick" (or "Watson–Crick–Franklin") base pairs (guanine–cytosine and adenine–thymine) allow the DNA helix to maintain a regular helical structure that is subtly dependent on its nucleotide sequence.

Related publications (3)

Temperature dependence of internucleotide nitrogen-nitrogen scalar couplings in RNA

Chat with Graph Search

Performance Comparison of UWB Impulse-Based Multiple Access Schemes in Indoor Multipath Channels

Phase Modulation in Ingaasp Barrier, Reservoir, and Quantum-Well Electron-Transfer Structures, Grown by Chemical Beam Epitaxy

Gaussian pulse cascades: new analytical functions for rectangular selective inversion and in-phase excitation in NMR